Please use the bioinformatics tools to design these following items;
1. The real-time PCR primer and probe set(s) which can be used to distinguish between 2009 Swine-Origin Influenza A (H1N1)from other influenza subtypes. Please also describe what are gene(s)/region(s) that you choose? And give us the reason why?
2. The conventional PCR and sequencing primer set which can be used to identify oseltamivir resistance associated NA gene mutations: N1: H274Y
Note:a) Please show the size of PCR product and locate the position of PCR, probe, and sequencing primer used in #1 and #2b) What kind/type/name of the programs that you use for #1 and #2?Hence: a) Algorithm used to design PCR primer, real-time PCR primer, and sequencing primer are different.
Do alignment for find area which cannot be found in the other subtype
sequence in red box represent in only 2009 swine flu H1N1
Probe are designated using Primer3 program (condition are shown in below)
Probe are GGAACGTGTTACCCAGGAGA shown in the brown box
2The conventional PCR and sequencing primer set which can be used to identify oseltamivir resistance associated NA gene mutations: N1: H274Y
Find sequence of influenza in influenza virus resource database
compare sequence between wild type and H274Y mutant strain using clustal x program
The result show amino acid position 274 of wild type strain change from H to Y
The result from nucleotide sequence also correlate CAC change to TAT in mutant strain
sequencing primer are designated using Primo Sequencing 3.4: Sequencing Primer Design
Conventional PCR primer are design using Primer 3 program
condition which are use in primer designation
The result show amino acid position 274 of wild type strain change from H to Y
The result from nucleotide sequence also correlate CAC change to TAT in mutant strain 
sequencing primer are designated using Primo Sequencing 3.4: Sequencing Primer Design
Conventional PCR primer are design using Primer 3 program
condition which are use in primer designation
result
